View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19285_low_12 (Length: 309)
Name: NF19285_low_12
Description: NF19285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19285_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 96 - 292
Target Start/End: Complemental strand, 24506219 - 24506023
Alignment:
| Q |
96 |
ttggtatgggttttaagattcttagagatttcaacttagctatgctagctaagcaagtctggcgcttccacaagcaacctgaatccctcattgctaaaag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24506219 |
ttggtatgggttttaagattcttagagatttcaagttagctatgctagctaaccaagtctggcgcttccacaagcaacctgaatccatcattgctaaaag |
24506120 |
T |
 |
| Q |
196 |
ttacaaggccgaatactttcccaatacggatattctacatgctcccattggaaatagtccaagctttgcttggaggagcatccaacaatctatttag |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24506119 |
ttacaaggccgaatactttcccaatacggatattctacatgctcccattggaaatagtccaagctttgcttggaggagcatccaacaatctatttag |
24506023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 24506345 - 24506256
Alignment:
| Q |
1 |
tgctccctaagggtttatgtgaaaaaatagagaaggttgtttgtgccttttggtggggca-caagggtaataatagagaaagatccattg |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24506345 |
tgctccctaagggtttatgtgaaaaaatagagaaggttgtttgtgccttttggtggggcagcaagggtaataatagagaaagatccattg |
24506256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 115 - 162
Target Start/End: Complemental strand, 43944507 - 43944460
Alignment:
| Q |
115 |
tcttagagatttcaacttagctatgctagctaagcaagtctggcgctt |
162 |
Q |
| |
|
|||||||||||||||||| |||||||| || || |||||||||||||| |
|
|
| T |
43944507 |
tcttagagatttcaacttggctatgctggccaaacaagtctggcgctt |
43944460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University