View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19287_high_14 (Length: 240)
Name: NF19287_high_14
Description: NF19287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19287_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 32195417 - 32195205
Alignment:
| Q |
14 |
atactcatcatatatgttgaaattacttggaacaccgatttgatacgcacttccctaccggctctagatagtgcctttccactccaagagttcannnnnn |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32195417 |
atactcatcatatatgctgaaattacttggaacaccgatttgatacgcacttccctaacggctctagatagtgcctttccactccaagagttcatttttt |
32195318 |
T |
 |
| Q |
114 |
nnccacacacaatctttgataattttgaacattgactttttgcttcttcctatcgtagatgacaaccccaaacatttgcatgtaccatgagctatattca |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32195317 |
ttccacacacaatctctgataattttgaacattgactttttgcttcttcctatcgtagatgacaaccccaaacatttgcatgtaccatgagctatattca |
32195218 |
T |
 |
| Q |
214 |
catccaacatgat |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32195217 |
catccaacatgat |
32195205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University