View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19287_high_15 (Length: 235)
Name: NF19287_high_15
Description: NF19287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19287_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 4059096 - 4058872
Alignment:
| Q |
1 |
taactcttttatcggggaaaatagtagcaaaatgagttagaaacatatacactgtttgattttaagttatattatatggtcataactgccgtgttatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4059096 |
taactcttttatcggggaaaatagtagcaaaatgagttagaaacatatacactgtttgattttaagttatattatatggtcataactgccgtgttatgta |
4058997 |
T |
 |
| Q |
101 |
ttgattgaatttcatgttgatatatcat---ataactttcatacttgactatattgtgcttaagtgaaatatttgttgtttgcttcttaagtgaaatgat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058996 |
ttgattgaatttcatgttgatatatcatataataactttcatacttgactatattgtgcttaagtgaaatatttgttgtttgcttcttaagtgaaatgat |
4058897 |
T |
 |
| Q |
198 |
tgacatagtatgatatatgaatcat |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
4058896 |
tgacatagtatgatatatgaatcat |
4058872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University