View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19287_high_16 (Length: 223)
Name: NF19287_high_16
Description: NF19287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19287_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 21 - 142
Target Start/End: Complemental strand, 39251179 - 39251060
Alignment:
| Q |
21 |
aatcataggaactaaattgatggatttgacatacttcataaactatttannnnnnnnataaaatttagtcattaaattgaagagaaagtgatagtttaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39251179 |
aatcataggaactaaattgatggatt-gacatacttcataaactatttattttttt-ataaaatttagtcactaaattgaagagaaagtgatagtttaaa |
39251082 |
T |
 |
| Q |
121 |
gattaaactaatagtttattct |
142 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39251081 |
gattaaactaatagtttattct |
39251060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 208
Target Start/End: Complemental strand, 39251034 - 39250994
Alignment:
| Q |
168 |
tataatgttcttgctctggcccacttttgtgggcaattagt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39251034 |
tataatgttcttgctctggcccacttttgtgggcaattagt |
39250994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University