View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19287_high_16 (Length: 223)

Name: NF19287_high_16
Description: NF19287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19287_high_16
NF19287_high_16
[»] chr1 (2 HSPs)
chr1 (21-142)||(39251060-39251179)
chr1 (168-208)||(39250994-39251034)


Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 21 - 142
Target Start/End: Complemental strand, 39251179 - 39251060
Alignment:
21 aatcataggaactaaattgatggatttgacatacttcataaactatttannnnnnnnataaaatttagtcattaaattgaagagaaagtgatagtttaaa 120  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||        |||||||||||||| ||||||||||||||||||||||||||||    
39251179 aatcataggaactaaattgatggatt-gacatacttcataaactatttattttttt-ataaaatttagtcactaaattgaagagaaagtgatagtttaaa 39251082  T
121 gattaaactaatagtttattct 142  Q
    ||||||||||||||||||||||    
39251081 gattaaactaatagtttattct 39251060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 208
Target Start/End: Complemental strand, 39251034 - 39250994
Alignment:
168 tataatgttcttgctctggcccacttttgtgggcaattagt 208  Q
    |||||||||||||||||||||||||||||||||||||||||    
39251034 tataatgttcttgctctggcccacttttgtgggcaattagt 39250994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University