View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19287_high_9 (Length: 250)
Name: NF19287_high_9
Description: NF19287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19287_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 43560908 - 43561025
Alignment:
| Q |
1 |
ttacctgagtgagtgtttgtgtcatttaaacgttttcaaaagtggtggtagaaaaatattgttatgttgtgtgtggggtgaagagggagagtaactcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43560908 |
ttacctgagtgagtgtttgtgtcatttaaacgttttcaaaagtggtggtagaaaaatattgttatgttgtgtgtggggtgaagagggagagtaactcaaa |
43561007 |
T |
 |
| Q |
101 |
ctaattgtgttcatttaa |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43561008 |
ctaattgtgttcatttaa |
43561025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 191 - 242
Target Start/End: Original strand, 43561098 - 43561149
Alignment:
| Q |
191 |
acattgagaggaaggtgctgcaatcaagtgggttttacgcaattcctatgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43561098 |
acattgagaggaaggtgctgcaatcaagtgggttttacgcaattcctatgct |
43561149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University