View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19287_low_11 (Length: 249)
Name: NF19287_low_11
Description: NF19287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19287_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 16 - 248
Target Start/End: Complemental strand, 4059388 - 4059159
Alignment:
| Q |
16 |
atagacggtgaaatggtgagtagaacaataggaatgtctaaattcccacttttgcatcatataggaatggatgcgttcgggcatcgagggattcaattgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
4059388 |
atagacggtgaaatggtgagtagaacaataggaatgtctaaattcccacttttgcatcatataggaacgggcgggttcgggcatcgagggattcaatt-- |
4059291 |
T |
 |
| Q |
116 |
ttcatccggacccccttgtgtgaaccctgtctaaaccgtaactgtgtttgttggacccgtggacctgttttaaactgacaatttctcttttttcagtccg |
215 |
Q |
| |
|
||||| |||||| | ||||| || ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4059290 |
-tcatctggacccgcctgtgtaaatcctatctaaaccgtaaacgtgtttgttggacccgtggacctgttttaaactgacaatttctctttttttagtccg |
4059192 |
T |
 |
| Q |
216 |
ggttgggcggattttctcgggttgtaggttttt |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
4059191 |
ggttgggcagattttctcgggttgtaggttttt |
4059159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University