View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19288_low_6 (Length: 256)
Name: NF19288_low_6
Description: NF19288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19288_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 16 - 157
Target Start/End: Original strand, 52593279 - 52593420
Alignment:
| Q |
16 |
atcactcatgtattattattacaaagagattaccttctatcacgcacaaataatatactactaccccatcataatcatttcatgatcacagactttttta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52593279 |
atcactcatgtattattattacaaagagattaccttctatcacgcacaaacaatatactactaccccatcataatcatttcatgatcacagactttttta |
52593378 |
T |
|
| Q |
116 |
aaaaggacaaaataaagagagacatactactgcctcatgatt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52593379 |
aaaaggacaaaataaagagagacatactactgcctcatgatt |
52593420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 247
Target Start/End: Original strand, 52593472 - 52593503
Alignment:
| Q |
216 |
ccagagcaagcagaggtgcaatagagaattat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52593472 |
ccagagcaagcagaggtgcaatagagaattat |
52593503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University