View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19289_high_21 (Length: 429)

Name: NF19289_high_21
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19289_high_21
NF19289_high_21
[»] chr5 (2 HSPs)
chr5 (18-178)||(14703501-14703661)
chr5 (247-310)||(14703365-14703428)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 14703661 - 14703501
Alignment:
18 cttggtacctttcttccacggtatccttgttcttcttcattcacctgaaaagtgatattgatgcagtcattaaaattgtcaagtactgctagattacaaa 117  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14703661 cttggtacctttcttccacggaatccttgttcttcttcattcacctgaaaagtgatattgatgcagtcattaaaattgtcaagtactgctagattacaaa 14703562  T
118 aacaggtagggttttctatggaaattacatgtcatgaaagtgacttgctagacataacaag 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14703561 aacaggtagggttttctatggaaattacatgtcatgaaagtgacttgctagacataacaag 14703501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 247 - 310
Target Start/End: Complemental strand, 14703428 - 14703365
Alignment:
247 ctactttagcctctcttattcaaatgtactcttgttgactcattgcttctagtacacaatacat 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
14703428 ctactttagcctctcttattcaaatgtactcttgttgactcattgcttctagtacataatacat 14703365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University