View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_high_32 (Length: 358)
Name: NF19289_high_32
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 266 - 299
Target Start/End: Complemental strand, 35872926 - 35872893
Alignment:
| Q |
266 |
atattataactttatttaatccatgtaggtaatc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35872926 |
atattataactttatttaatccatgtaggtaatc |
35872893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 12 - 49
Target Start/End: Complemental strand, 35873127 - 35873090
Alignment:
| Q |
12 |
atgaacctatgtagtagtggggtcgtaacttatgttat |
49 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35873127 |
atgatcctatgtagtagtggggtcgtaacttatgttat |
35873090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University