View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_high_35 (Length: 345)
Name: NF19289_high_35
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_high_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 18 - 335
Target Start/End: Complemental strand, 46260355 - 46260038
Alignment:
| Q |
18 |
cattctacgttggactcgcagtgggaaaatacttatggatgaatacctccaccgcgaaggatcgcgatagtcactgcgaaaagatgttgatatggctgaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46260355 |
cattctacgttggactcgcagtgggaaaatacttatggatgaacacctccaccgcgaaggatcgcgatagtcactgcgaaaagatgttgatatggcttaa |
46260256 |
T |
|
| Q |
118 |
tgaacaaccgtattacaaagaatcaaacggttgggatcacttcattacaatggggcgcatcacatgggattttcgtcgttccaaagatgaagattggggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46260255 |
tgaacaaccgtattacaaagaatcaaacggttgggatcacttcattacaatggggcgcatcacatgggattttcgtcgttccaaagatgaagattggggt |
46260156 |
T |
|
| Q |
218 |
tctagttgcatctacaagccagggttaagaaacatcactcgccttctgatagagcgtaatccatgggactatttcgatatcggtataccttaccccactg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46260155 |
tctagttgcatctacaagccagggttaagaaacatcactcgccttctgatagagcgtaatccatgggactatttcgatatcggtataccttaccccactg |
46260056 |
T |
|
| Q |
318 |
gattccaccctagttcat |
335 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46260055 |
gattccaccctagttcat |
46260038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University