View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19289_high_50 (Length: 278)

Name: NF19289_high_50
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19289_high_50
NF19289_high_50
[»] chr1 (1 HSPs)
chr1 (1-264)||(48805729-48805992)


Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 48805992 - 48805729
Alignment:
1 tgcttttgtcatcactgcaacaagtgaatttagcaaacaacagtttcacggggattcagatctcaaaacccgcacgtggtgtagaaagcaatctcgtggc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48805992 tgcttttgtcatcactgcaacaagtgaatttagcaaacaacagtttcacggggattcagatctcaaaacccgcacgtggtgtagaaagcaatctcgtggc 48805893  T
101 attgaacttaggatttaacagaatccaaggttacgcgcccgcgaatctcgctgcatatccattgctgtcgtttttgtcgattcgtcacaactcgctacgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48805892 attgaacttaggatttaacagaatccaaggttacgcgcccgcgaatctcgctgcatatccattgctgtcgtttttgtcgattcgtcacaactcgctacgt 48805793  T
201 ggcaatataccattggagtatggacaaataaagagtatgaagaggttgttcttggatggaaact 264  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
48805792 ggcaatataccattggagtatggacagataaagagtatgaagaggttgttcttggatggaaact 48805729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University