View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19289_high_66 (Length: 241)

Name: NF19289_high_66
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19289_high_66
NF19289_high_66
[»] chr1 (1 HSPs)
chr1 (97-225)||(6720788-6720916)
[»] chr3 (1 HSPs)
chr3 (166-225)||(52219871-52219930)


Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 97 - 225
Target Start/End: Complemental strand, 6720916 - 6720788
Alignment:
97 tgtgatgtctaagagtttcatatacaattgttgcatggatggttattttactttgtttcatgaaaaatgtgcaggttcttcccaatggtattgaagtgaa 196  Q
    |||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
6720916 tgtgatttctaagagtttcacatacaattgttgcatggatggttatattactttgtttcatgaaaaatgtgcaggttcttaccaatggtattgaagtgaa 6720817  T
197 gctgcagaggaatgctcttagtgtgattg 225  Q
    |||||||||||||||||||||||||||||    
6720816 gctgcagaggaatgctcttagtgtgattg 6720788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 166 - 225
Target Start/End: Complemental strand, 52219930 - 52219871
Alignment:
166 tgcaggttcttcccaatggtattgaagtgaagctgcagaggaatgctcttagtgtgattg 225  Q
    ||||||||||| | ||||| ||||||||||||||||| ||||||||||||||||||||||    
52219930 tgcaggttcttactaatggaattgaagtgaagctgcaaaggaatgctcttagtgtgattg 52219871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University