View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_high_77 (Length: 231)
Name: NF19289_high_77
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_high_77 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 37559644 - 37559454
Alignment:
| Q |
18 |
aaagttaacataaaagatattttctttaaatttactactatgtcttcaataaacttagatttagtattattaacttggatcaaaagattggtttatgtat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37559644 |
aaagttaacataaaagatattttctttaaatttactactatgtcttcaataaacttagatttagtattattaacttcgatcaaaagattggtttatgtat |
37559545 |
T |
|
| Q |
118 |
tttaaagagcaattgcaaggtttgtatttgatgagtaaaggaaggaacaggtagaaagattcgtacctgaagcatat-ctacattttcagtc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
37559544 |
tttaaagagcaattgcaaggtttgtatttgatgagctaaggaa-aaacagacagaaagattcgtacctgaagcatatcctgcattttcagtc |
37559454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University