View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19289_low_19 (Length: 460)

Name: NF19289_low_19
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19289_low_19
NF19289_low_19
[»] chr8 (3 HSPs)
chr8 (221-287)||(19467760-19467826)
chr8 (221-287)||(19565441-19565507)
chr8 (221-288)||(23699275-23699342)
[»] chr7 (1 HSPs)
chr7 (244-287)||(10528847-10528890)


Alignment Details
Target: chr8 (Bit Score: 47; Significance: 1e-17; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 221 - 287
Target Start/End: Complemental strand, 19467826 - 19467760
Alignment:
221 tattataaaacggtttttatgttgtcctttaaatggggtgttgtattagatcatatttgttgtagtg 287  Q
    |||||||||||||||||| | | ||||||||| || |||||||||||||||||||||||||||||||    
19467826 tattataaaacggtttttctttagtcctttaattgtggtgttgtattagatcatatttgttgtagtg 19467760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 221 - 287
Target Start/End: Complemental strand, 19565507 - 19565441
Alignment:
221 tattataaaacggtttttatgttgtcctttaaatggggtgttgtattagatcatatttgttgtagtg 287  Q
    |||||||||||||||||| | | ||||||||| || |||||||||||||||||||||||||||||||    
19565507 tattataaaacggtttttctttagtcctttaattgtggtgttgtattagatcatatttgttgtagtg 19565441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 221 - 288
Target Start/End: Complemental strand, 23699342 - 23699275
Alignment:
221 tattataaaacggtttttatgttgtcctttaaatggggtgttgtattagatcatatttgttgtagtga 288  Q
    |||||||||||||||||| | | |||||||||  | ||||||||||||||||||||||||||||||||    
23699342 tattataaaacggtttttctttagtcctttaatcgtggtgttgtattagatcatatttgttgtagtga 23699275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 244 - 287
Target Start/End: Complemental strand, 10528890 - 10528847
Alignment:
244 gtcctttaaatggggtgttgtattagatcatatttgttgtagtg 287  Q
    |||||||||| | |||||||||||||||||||||| ||||||||    
10528890 gtcctttaaaagtggtgttgtattagatcatatttcttgtagtg 10528847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University