View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_low_22 (Length: 429)
Name: NF19289_low_22
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 14703661 - 14703501
Alignment:
| Q |
18 |
cttggtacctttcttccacggtatccttgttcttcttcattcacctgaaaagtgatattgatgcagtcattaaaattgtcaagtactgctagattacaaa |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14703661 |
cttggtacctttcttccacggaatccttgttcttcttcattcacctgaaaagtgatattgatgcagtcattaaaattgtcaagtactgctagattacaaa |
14703562 |
T |
|
| Q |
118 |
aacaggtagggttttctatggaaattacatgtcatgaaagtgacttgctagacataacaag |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14703561 |
aacaggtagggttttctatggaaattacatgtcatgaaagtgacttgctagacataacaag |
14703501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 247 - 310
Target Start/End: Complemental strand, 14703428 - 14703365
Alignment:
| Q |
247 |
ctactttagcctctcttattcaaatgtactcttgttgactcattgcttctagtacacaatacat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14703428 |
ctactttagcctctcttattcaaatgtactcttgttgactcattgcttctagtacataatacat |
14703365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University