View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19289_low_33 (Length: 358)

Name: NF19289_low_33
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19289_low_33
NF19289_low_33
[»] chr1 (2 HSPs)
chr1 (266-299)||(35872893-35872926)
chr1 (12-49)||(35873090-35873127)


Alignment Details
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 266 - 299
Target Start/End: Complemental strand, 35872926 - 35872893
Alignment:
266 atattataactttatttaatccatgtaggtaatc 299  Q
    ||||||||||||||||||||||||||||||||||    
35872926 atattataactttatttaatccatgtaggtaatc 35872893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 12 - 49
Target Start/End: Complemental strand, 35873127 - 35873090
Alignment:
12 atgaacctatgtagtagtggggtcgtaacttatgttat 49  Q
    |||| |||||||||||||||||||||||||||||||||    
35873127 atgatcctatgtagtagtggggtcgtaacttatgttat 35873090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University