View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_low_37 (Length: 343)
Name: NF19289_low_37
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 67 - 245
Target Start/End: Complemental strand, 24923392 - 24923214
Alignment:
| Q |
67 |
gtaatttgaatattcgattctaatctggaattcttgttatgatatttaggttaatatcttacttgtaattctcggtgagattgaaggatattcaatttga |
166 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
24923392 |
gtaatttgaatatgcgattctaatctggaattcttgttatgatatttaggttaatatcttacttgtaattttcgttgagattgaaggatattcaatttga |
24923293 |
T |
 |
| Q |
167 |
catagtttgaaattgaaatttaatgaaaaggattagatttcttgttacttatgattactttcttatacatcctgttagc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24923292 |
catagtttgaaattgaaatttaatgaaaaggattacatttcttattacttatgattactttcttatacatcctgttagc |
24923214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University