View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_low_41 (Length: 323)
Name: NF19289_low_41
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 10 - 204
Target Start/End: Original strand, 44540876 - 44541071
Alignment:
| Q |
10 |
aacaatattatgatgcaagaaatgaaaa-aatcttaccagttacgaccaagggcttcatgagcacgatacccagttgagatttcaaagactttgttgaca |
108 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44540876 |
aacaaaattatgatgcaagaaatgaaaaaaatcttaccagttacgaccaagggcttcatgagcacgatacccagttgagatttcaaagactttgttgaca |
44540975 |
T |
 |
| Q |
109 |
taaatgattggaaaatctgattcaagtgcatctgatacaacaaaagatgttggtgttgttgggtagaagaaaagttctggttttaatggaagctca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44540976 |
taaatgattggaaaatctgattcaagtgcatctgatacaacaaaagatgttggtgttgttgggtagaagaaaagttctggttttaatggaagctca |
44541071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 306
Target Start/End: Original strand, 44541136 - 44541173
Alignment:
| Q |
269 |
atctcttcccaaccttttgattttgattatgaacctct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44541136 |
atctcttcccaaccttttgattttgattatgaacctct |
44541173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University