View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_low_61 (Length: 250)
Name: NF19289_low_61
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_low_61 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 54281042 - 54280793
Alignment:
| Q |
1 |
ggaccacactcaattgtgtgataagttgatgattgataattcataagataggcaaggtaaaggcaaactcttttcgagtttgttgtaagaaatttctact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54281042 |
ggaccacactcaattgtgtgataagttgatgattgataattcataagataggcagggtaaaggcaaactcttttcgagtttgttgtaagacatttctact |
54280943 |
T |
 |
| Q |
101 |
catacttgatgcgtgatatcaaaatggtttaaagggcatcatcctatacgaacatggaaatcggaaagcaatatatgttacctacttgagctacatgata |
200 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54280942 |
catacttgatgagtgatatcaaaacggtttaaagggcatcatcctatacgaacatggaaatcggaaagcaatatatgttacctacttgagctacatgata |
54280843 |
T |
 |
| Q |
201 |
tatattaactacactagacattggagatattttgtttggtgcacaatgaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54280842 |
tatattaactacactagacattggagatattttgtttggtgcacaatgaa |
54280793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University