View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_low_65 (Length: 243)
Name: NF19289_low_65
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_low_65 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 2 - 225
Target Start/End: Complemental strand, 5744687 - 5744466
Alignment:
| Q |
2 |
ttgatttcgcttctcaaattgaga--aattcactttagaatactacaaataaaaaa-tttaagccttaactatggttgattttctcataaaaaattatca |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| | | | | | || ||||||||||| |
|
|
| T |
5744687 |
ttgatttcgcttctcaaattgagataaattcactttagaatactacaaataaaaaaatttaagccttaggaaa---ttaggtaccca--aaaaattatca |
5744593 |
T |
|
| Q |
99 |
cattacttaatttatactctaaagctaataacagaaattaggtacccaaaaaatcagcaacggttctgccattggaaaatcttcccgttggacctctagg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5744592 |
cattacttaatttatactctaaagctaataacagaaattaggtacccaaaaaatcggcaacggttctgccattggaaaatcttcccgttggacctctagg |
5744493 |
T |
|
| Q |
199 |
gaaatcaactccataaggtaagaaatt |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5744492 |
gaaatcaactccataaggtaagaaatt |
5744466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University