View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_low_67 (Length: 241)
Name: NF19289_low_67
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_low_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 97 - 225
Target Start/End: Complemental strand, 6720916 - 6720788
Alignment:
| Q |
97 |
tgtgatgtctaagagtttcatatacaattgttgcatggatggttattttactttgtttcatgaaaaatgtgcaggttcttcccaatggtattgaagtgaa |
196 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6720916 |
tgtgatttctaagagtttcacatacaattgttgcatggatggttatattactttgtttcatgaaaaatgtgcaggttcttaccaatggtattgaagtgaa |
6720817 |
T |
 |
| Q |
197 |
gctgcagaggaatgctcttagtgtgattg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6720816 |
gctgcagaggaatgctcttagtgtgattg |
6720788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 166 - 225
Target Start/End: Complemental strand, 52219930 - 52219871
Alignment:
| Q |
166 |
tgcaggttcttcccaatggtattgaagtgaagctgcagaggaatgctcttagtgtgattg |
225 |
Q |
| |
|
||||||||||| | ||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52219930 |
tgcaggttcttactaatggaattgaagtgaagctgcaaaggaatgctcttagtgtgattg |
52219871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University