View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_low_73 (Length: 237)
Name: NF19289_low_73
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_low_73 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 31053302 - 31053101
Alignment:
| Q |
1 |
ttggactacgagcggtagcctcgttggattggatcatcatattggattaataagagtaaccacatgagtgagattgaatgctacatcttcacctaaaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31053302 |
ttggactacgagcggtagcctcgttggattggatcatcatattggattaataagagtaatcacatgagtgagattgaatactacatcttcacctaaaacc |
31053203 |
T |
 |
| Q |
101 |
gtaaaggcattgagtttacaagtactctcacttatatgttgttcaacctgaactattacatgcattgtgaaaccttaactcacttttgacataccacaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31053202 |
gtaaaggcattgagtttacaagtactctcacttatatgttgttcaacctgaactattacatgcattgtgaaaccttaactcacttttgacataccacaat |
31053103 |
T |
 |
| Q |
201 |
at |
202 |
Q |
| |
|
|| |
|
|
| T |
31053102 |
at |
31053101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 200 - 229
Target Start/End: Complemental strand, 31052134 - 31052105
Alignment:
| Q |
200 |
tatgtgtttaagtcaagagtcttgatgatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31052134 |
tatgtgtttaagtcaagagtcttgatgatg |
31052105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University