View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_low_77 (Length: 234)
Name: NF19289_low_77
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_low_77 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 23 - 234
Target Start/End: Original strand, 4412009 - 4412234
Alignment:
| Q |
23 |
ttatgctacttcttttgggactattcttgcttatatcatgtgagctattaattcttaagcctacattagatcagagaacctcgtggtttctgtacaacat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4412009 |
ttatgctacttcttttgggactattcttgcttatatcatgtgaggtattaattcttaagcctacattagatcagagaacctcgtggtttctgtacaacat |
4412108 |
T |
 |
| Q |
123 |
tgacctggtggaagctttttcctctt--------------acctataagcttatttaactttgaattaatgtgagtaaactatcaagcgagaaaatcaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4412109 |
tgacctggtggaagctttttcctcttttacagattcactcacctataagcttatttaactttgaattaatgtgagtaaactatcaagcgagaaaatcaag |
4412208 |
T |
 |
| Q |
209 |
attgctatttcaaaaaactcataatt |
234 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4412209 |
attgctatttcaaaaaactcataatt |
4412234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University