View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19289_low_79 (Length: 231)

Name: NF19289_low_79
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19289_low_79
NF19289_low_79
[»] chr8 (2 HSPs)
chr8 (86-207)||(5982698-5982819)
chr8 (129-195)||(5947065-5947131)


Alignment Details
Target: chr8 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 86 - 207
Target Start/End: Original strand, 5982698 - 5982819
Alignment:
86 tacagcgcatgcttcataaaactcttatcacatcgtaaagtatatgcatgctggcctcctctacgtacgtcaaattaaaggacactagcctttaattcac 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
5982698 tacagcgcatgcttcataaaactcttatcacatcgtaaagtatatgcatgctggcctcctctacgtacgtcaaattaaagtacactagcctttaattcac 5982797  T
186 caggatgtagtatacggctttt 207  Q
    ||||||||||||||||||||||    
5982798 caggatgtagtatacggctttt 5982819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 195
Target Start/End: Original strand, 5947065 - 5947131
Alignment:
129 atgcatgctggcctcctctacgtacgtcaaattaaaggacactagcctttaattcaccaggatgtag 195  Q
    ||||||||||||||||||||| || ||||||||||||||||||||||||||||| || | |||||||    
5947065 atgcatgctggcctcctctacctaggtcaaattaaaggacactagcctttaattgacaaagatgtag 5947131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University