View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_low_80 (Length: 231)
Name: NF19289_low_80
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 42851800 - 42851621
Alignment:
| Q |
1 |
tgtcaatagatagaagactcatcttaaagtagatatagtctttgtttgtcaaggccaattttggaacagatagcttataaactcatatgaccaaaacata |
100 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42851800 |
tgtcactagatagaagacttatcttaaagtagatatagtctttgtttgtcaaggccaattttcgaacagatagcttataaactcatatgaccaaaacata |
42851701 |
T |
 |
| Q |
101 |
catatttggtaacaatannnnnnnctcttgagtttagagcgttcttttactaatttatagcatttgagcttatatcttat |
180 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42851700 |
catatttggtaacaatatttttttctcttcagtttagagcgtacttttactaatttatagcatttgagcttatatcttat |
42851621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University