View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19289_low_82 (Length: 229)
Name: NF19289_low_82
Description: NF19289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19289_low_82 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 11 - 138
Target Start/End: Complemental strand, 5744851 - 5744724
Alignment:
| Q |
11 |
catcatcatcaaaagaagaagaaaaattaatcaataaaaatcacgagttcgaaatatattaacaatatactcatttttcatcccacttacgatatagatt |
110 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5744851 |
catcatcatcaaaagaagaaaaaaaattaatcaataaaaatcacgagttcgaaatatattaacaatatactcatttttcatcccacttacgatatagatt |
5744752 |
T |
 |
| Q |
111 |
ttactaaacaaaagtagtgtttctacaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5744751 |
ttactaaacaaaagtagtgtttctacaa |
5744724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University