View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19291_high_20 (Length: 270)
Name: NF19291_high_20
Description: NF19291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19291_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 36527142 - 36526887
Alignment:
| Q |
1 |
gtaattagcagttttaacatatttcaattgctgtttttcccatgcaaaatattactattcaattcaatatcagtatctttgat--gcaatagccaacaat |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36527142 |
gtaattagcagttttaacatatttcaattgctgtttttcccatgcaaaatattactattcaattcaatatcagtatctttgatatgcaatagccaacaat |
36527043 |
T |
 |
| Q |
99 |
caaaattccaatgcatcatctctttgtttcttcataggatttcaaacttcaggttgtctaagggacaactaactaatttactgcgccacttttaaaaagc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36527042 |
caaaattccaatgcatcatctctttgtttcttcataggatttcaaacttcaggttgtctaagggacaactaactaatttactgcgccacttttaaaaagc |
36526943 |
T |
 |
| Q |
199 |
tttcattataaattgtaactttcattgtaaatttgtaatgcactttaagaaaaaat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36526942 |
tttcattataaattgtaactttcattgtaaatttgtaatgcactttaagaaaaaat |
36526887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University