View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19291_high_27 (Length: 250)
Name: NF19291_high_27
Description: NF19291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19291_high_27 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 40310235 - 40309998
Alignment:
| Q |
13 |
aatatcattgaccttttgagttttatgatcggttgcttcaattttttcttgtacagaatcacgatttgatattagctttttcttttctctttctacatct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310235 |
aatatcattgaccttttgagttttatgatcggttgcttcaattttttcttgtactgaatcatgatttgatattagctttttcttttctctttctacatct |
40310136 |
T |
 |
| Q |
113 |
ttaatgattttgtaagctcgatatacacatagtttattgattgtcttgtacagaataatcgatatgatacaaacaacagttatggttatcttgtatgtag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310135 |
ttaatgattttgtaagctcgatatacacatagtttattgatcgtctttatcagaataatcgatatgatacaaacaacagttatggttatcttgtatgtag |
40310036 |
T |
 |
| Q |
213 |
caagtccaatggcaaggtaatctgaaaaataaccaatc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310035 |
caagtccaatggcaaggtaatctgaaaaataaccaatc |
40309998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University