View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19291_low_12 (Length: 396)
Name: NF19291_low_12
Description: NF19291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19291_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 7e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 184 - 382
Target Start/End: Complemental strand, 46727002 - 46726804
Alignment:
| Q |
184 |
cacacaactgcgaggtcttgaatttgaaagtgtccagtgtaacaatatcaatatttgtcagttgagttaggccttatgagcggagagattttaactgaga |
283 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46727002 |
cacacaactgcgaggtcttgaatttgaagttgtccagtgtaacaatatcaatatttgtcggttgagttaggccttatgagcggagagattttaactgaga |
46726903 |
T |
 |
| Q |
284 |
gaaagtgtaaaattacattttgttccattgtcatatttaagataagattttgtacttgtactcacctcaggctgcgtatgatggaaaccctgcacagtg |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46726902 |
gaaagtgtaaaattacattttgttccattgtcatatttaagataagattttgtacttgtactcacctcaggccgcgtatgatggaaaccctgcacagtg |
46726804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 46727206 - 46727113
Alignment:
| Q |
1 |
gaaattgaagaagaacctacttgcactcataacattgataccgaagctgccaaaacttggatttacccaggtactaataattcaccggtagtag |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46727206 |
gaaattgaagaagaacctacttgcactcataacattgataccgaagctgccaaaacttggatttacccaggtactattaattcaccggtagtag |
46727113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University