View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19291_low_23 (Length: 256)
Name: NF19291_low_23
Description: NF19291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19291_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 5 - 241
Target Start/End: Complemental strand, 2632055 - 2631822
Alignment:
| Q |
5 |
ggtagataatactttcaataactacaagaaatactaaaaattatcctggctcatgatgaaaggatgaatttctttcaaaattttggattcatacggttat |
104 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2632055 |
ggtaaataaaactttcaataactacaagaaatactaaaaattatcctggctcatgatgaaaggatgaatttctttcaaaattttggattcatacggttat |
2631956 |
T |
 |
| Q |
105 |
acatctannnnnnnnnnnnnnnnnaatatattaatttttcaactcgcactacacctgtattgtacgtataaaatagatagatcgaagttacattgagtat |
204 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2631955 |
acatctatagtagtagtagta---aatatattaatttttcaaatcgcactacacctgtattgtacgtataaaatagatagatcgatgttacattgagtat |
2631859 |
T |
 |
| Q |
205 |
acgtaccatcgatgttaatggagtcgttgtcctatct |
241 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2631858 |
acgtaccatcgatggtaatggagtcgttgtcctatct |
2631822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University