View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19291_low_29 (Length: 249)
Name: NF19291_low_29
Description: NF19291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19291_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 144 - 240
Target Start/End: Original strand, 32563851 - 32563947
Alignment:
| Q |
144 |
ccaataatggtgaatgaagccgacctcttttccatgcctaaatcaaataatgtaattgacttgtcgacttgacgtcaatatcatcatcgtacctttg |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32563851 |
ccaataatgttgaatgaagccgacctcttttccatgcttaaatcaaataatgtaattgacttgttgacttgacgtcaatatcatcatcgtacctttg |
32563947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 32563759 - 32563812
Alignment:
| Q |
1 |
tttcaaatacgtattttaatcaaacccgtgcatttagtgaagattcctagtatt |
54 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
32563759 |
tttcaaatacgaattttaatcaaacccgtgcgtttagtggagattcctagtatt |
32563812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 85 - 124
Target Start/End: Original strand, 32563812 - 32563851
Alignment:
| Q |
85 |
ttatactgtgctttttggtagcttcctttcacattccacc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32563812 |
ttatactgtgctttttggtagcttcctttcacattccacc |
32563851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 161 - 206
Target Start/End: Complemental strand, 28859249 - 28859204
Alignment:
| Q |
161 |
agccgacctcttttccatgcctaaatcaaataatgtaattgacttg |
206 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28859249 |
agccgaccacttttccatgctcaaatcaaataatgtaattgacttg |
28859204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University