View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19292_high_18 (Length: 228)

Name: NF19292_high_18
Description: NF19292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19292_high_18
NF19292_high_18
[»] chr4 (2 HSPs)
chr4 (104-228)||(23211264-23211388)
chr4 (7-39)||(23211167-23211199)
[»] chr2 (1 HSPs)
chr2 (157-187)||(20650746-20650776)
[»] chr7 (1 HSPs)
chr7 (155-183)||(14247597-14247625)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 104 - 228
Target Start/End: Original strand, 23211264 - 23211388
Alignment:
104 ggataacaatgtttgaaagatgatgtacatgttagatatgtatccatcatttatttattttaggcttaatagcagttttacccctttaactttcttaatt 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23211264 ggataacaatgtttgaaagatgatgtacatgttagatatgtatccatcatttatttattttaggcttaatagcagttttacccctttaactttcttaatt 23211363  T
204 tgagagtttgggatggtaatcaaaa 228  Q
    |||||||||||||||||||| ||||    
23211364 tgagagtttgggatggtaataaaaa 23211388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 39
Target Start/End: Original strand, 23211167 - 23211199
Alignment:
7 acttcaacttaaccctacaagtatctacgcaac 39  Q
    |||||||||||||||||||||||||||||||||    
23211167 acttcaacttaaccctacaagtatctacgcaac 23211199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 187
Target Start/End: Complemental strand, 20650776 - 20650746
Alignment:
157 tttattttaggcttaatagcagttttacccc 187  Q
    |||||||||||||||||||||||||||||||    
20650776 tttattttaggcttaatagcagttttacccc 20650746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 183
Target Start/End: Complemental strand, 14247625 - 14247597
Alignment:
155 tatttattttaggcttaatagcagtttta 183  Q
    |||||||||||||||||||||||||||||    
14247625 tatttattttaggcttaatagcagtttta 14247597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University