View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19292_high_18 (Length: 228)
Name: NF19292_high_18
Description: NF19292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19292_high_18 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 104 - 228
Target Start/End: Original strand, 23211264 - 23211388
Alignment:
| Q |
104 |
ggataacaatgtttgaaagatgatgtacatgttagatatgtatccatcatttatttattttaggcttaatagcagttttacccctttaactttcttaatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23211264 |
ggataacaatgtttgaaagatgatgtacatgttagatatgtatccatcatttatttattttaggcttaatagcagttttacccctttaactttcttaatt |
23211363 |
T |
|
| Q |
204 |
tgagagtttgggatggtaatcaaaa |
228 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
23211364 |
tgagagtttgggatggtaataaaaa |
23211388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 39
Target Start/End: Original strand, 23211167 - 23211199
Alignment:
| Q |
7 |
acttcaacttaaccctacaagtatctacgcaac |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23211167 |
acttcaacttaaccctacaagtatctacgcaac |
23211199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 187
Target Start/End: Complemental strand, 20650776 - 20650746
Alignment:
| Q |
157 |
tttattttaggcttaatagcagttttacccc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20650776 |
tttattttaggcttaatagcagttttacccc |
20650746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 183
Target Start/End: Complemental strand, 14247625 - 14247597
Alignment:
| Q |
155 |
tatttattttaggcttaatagcagtttta |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14247625 |
tatttattttaggcttaatagcagtttta |
14247597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University