View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19292_high_8 (Length: 294)
Name: NF19292_high_8
Description: NF19292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19292_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 13770658 - 13770470
Alignment:
| Q |
16 |
cattcctcaggcccaagccccaacccaagttgaagctcagcccgagccggagcctgtgcctttcaccatgcctgctgattgggacaacagcttcatggac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
13770658 |
cattcctcaggcccaagccccaacccaagttgaagctcagcccgagccggagcctgtgcctttcaccatgcctgctgattgggacagcatcttcatggac |
13770559 |
T |
|
| Q |
116 |
ttttggacttctgaagacatggttgatcccatccgtcacctgctttataactaagaaactaataattattattgcaaaaatggaccacc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13770558 |
ttttggacttctgaagacatggttgatcccatccgtcacctgttttataactaagaaactaataattattattgcaaaaatggaccacc |
13770470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 251 - 284
Target Start/End: Complemental strand, 13770423 - 13770390
Alignment:
| Q |
251 |
aaatttcgtgactgtataaactatgttgtctgtg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
13770423 |
aaatttcgtgactgtataaactatgttgtttgtg |
13770390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University