View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19292_low_13 (Length: 250)
Name: NF19292_low_13
Description: NF19292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19292_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 912206 - 912442
Alignment:
| Q |
1 |
ttttgtatcaccgacacttcggatggaagacatgtccgaataccgagacttgcatctacgttcaattaactcaatgtttcatgttcgatgtctgtatgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
912206 |
ttttgtatcaccgacacttcggatggaagacatgtccgaataccgagacttgcatctacgttcaattaactcaatgtttcatgttcgatgtctgtatcaa |
912305 |
T |
|
| Q |
101 |
tcctacatggttcacatagtannnnnnnnnnnnnnnnnataaacaactaaattagtcactcatagagcactcttaacataattaagatagtcataacata |
200 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
912306 |
tcctacatggttgacatagtgtttttattttattttttataaacaactaaattagtcactcatagagcactcttaacataattaagatagtcataacata |
912405 |
T |
|
| Q |
201 |
acataaatttggagtgtcttccaaatgtttcagattc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
912406 |
acataaatttggagtgtcttccaaatgtttcagattc |
912442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University