View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19292_low_18 (Length: 229)
Name: NF19292_low_18
Description: NF19292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19292_low_18 |
 | |
|
| [»] scaffold0110 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0110 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 212
Target Start/End: Original strand, 37532 - 37728
Alignment:
| Q |
16 |
atgaaacgacgtaacacgaggaaaactatgttccgtgtggttggagtttacttttctaccccttcaattgctctttatgctataaatttctgccctttca |
115 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37532 |
atgaaacgaggtaacacgagaaaaactatgttccgtgtggttggagtttacttttctaccccttcaattgctctttatgctataaatttctgccctttca |
37631 |
T |
|
| Q |
116 |
attgctctttatgttgataaatatcattcaaaggttgattgaatgagtagaagcgaaggaggaaagtggagattggaagacaattgagagcgtgcct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37632 |
attgctctttatgttgataaatatcattcaaaggttgattgaatgagtacaagcgaaggaggaaagtggagattggaagagaattgagagcgtgcct |
37728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 204
Target Start/End: Complemental strand, 30028031 - 30027982
Alignment:
| Q |
155 |
tgaatgagtagaagcgaaggaggaaagtggagattggaagacaattgaga |
204 |
Q |
| |
|
|||||||||| || |||||||| |||||||||||||||||| |||||||| |
|
|
| T |
30028031 |
tgaatgagtaaaatcgaaggagaaaagtggagattggaagagaattgaga |
30027982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University