View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19294_low_1 (Length: 297)
Name: NF19294_low_1
Description: NF19294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19294_low_1 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 153 - 297
Target Start/End: Complemental strand, 51057135 - 51056991
Alignment:
| Q |
153 |
attcactgcaaatttttaaaactcttaaattgaaatctgcaaaggacagtagtattaaaaatcaattatcatttttaaattaatggtaaatatcatatgt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51057135 |
attcactgcaaatttttaaaactcttaaattgaaatctgcaagggacagtagtattaaaaatcaattatcatttttaaattaatggtaaatatcatatgt |
51057036 |
T |
|
| Q |
253 |
atgtcaacaaaaaatatgttttttaaaataacaatccttatttcc |
297 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51057035 |
atgtcaacaaaaaatatgtttgttaaaataacaatccttatttcc |
51056991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 13 - 95
Target Start/End: Complemental strand, 51057240 - 51057155
Alignment:
| Q |
13 |
aatattaagattttactggttaaatatgtttttcgtccttacaac---gagaccttctaaatttgatccatatgtaatttttatga |
95 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| || |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
51057240 |
aatattaagattttactggttaaatatatttttcgtccttaccactttgagaccttctaagtttgacccatatgtaatttttatga |
51057155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University