View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19295_high_9 (Length: 270)
Name: NF19295_high_9
Description: NF19295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19295_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 79 - 238
Target Start/End: Original strand, 28826034 - 28826193
Alignment:
| Q |
79 |
aagaaatttgttttttgaaaatggtcgtttataaaagaatggggtgtaggtagccgttttccccaacacattcgacaaaagcaaaggaatacttattggg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28826034 |
aagaaatttgttttttgaaaatggtcgtttataaaagaatggggtgtaggtagcagttttccccaacacattcgacaaaagcaaaggaatacttattggg |
28826133 |
T |
 |
| Q |
179 |
ttatattaatgccactgaatatcatgaagagaatactataatatatacttactgagaatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
28826134 |
ttatattaatgccactgaatatcatgaagaaaacactataatatatacttactgagaatt |
28826193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University