View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19295_low_13 (Length: 227)
Name: NF19295_low_13
Description: NF19295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19295_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 28825683 - 28825902
Alignment:
| Q |
7 |
ctatctttgtaaatcataattgttgtccaagtatcccataaatcattggattttcaagtttacattttatatcactaaatgatatcaatatgcatgaaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28825683 |
ctatctttgtaaatcataattgttgtccaagtatcccataaatcattggattttcaagtttacattttatatcactaaatgatatcaatatgtatgaaga |
28825782 |
T |
 |
| Q |
107 |
gatttaattaatattacataaactactccaaattcaaatattatactttgcatctatgatgatgaagaatacacgtatacttgataaatagcatatattn |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||||| ||||||| |
|
|
| T |
28825783 |
gatttaattaatattacataaactactccaaattcaaatattatattttgcatctatgatgatgaagaatacacgtatacttg-ttaatagaatatatta |
28825881 |
T |
 |
| Q |
207 |
nnnnnnttgtttgctctcttt |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28825882 |
aaaatattgtttgctctcttt |
28825902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University