View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19295_low_14 (Length: 225)
Name: NF19295_low_14
Description: NF19295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19295_low_14 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 23 - 225
Target Start/End: Original strand, 20100904 - 20101106
Alignment:
| Q |
23 |
ttggaggggtatattttaatctttgaaggagaaaaacgaatgcatttaggtcacataccctgaaagatttcggtttcactatcacgcctcaaatcataca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20100904 |
ttggaggggtatattttaatctttgaaggagaaaaacgaatgcatttaggtcacataccctgaaagatttcgggttcactatcacgcctcaaatcataca |
20101003 |
T |
 |
| Q |
123 |
tttacaactgattgttcagtgttatttcagaatcataaatttacagttaaaactcttcagcgtcctctgttggtcttgtaatagggatggaccatcttcc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20101004 |
tttacaactgattgttcagtgtcatttcagaatcataaatttacagttaaaactcttcagcgtcctctgttggtcttgtaatagggatggaccatcttcc |
20101103 |
T |
 |
| Q |
223 |
caa |
225 |
Q |
| |
|
||| |
|
|
| T |
20101104 |
caa |
20101106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 20100848 - 20100887
Alignment:
| Q |
1 |
cgcaacaagaagaaactaggtcttggaggggtatatttta |
40 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
20100848 |
cgcaacaagaagaaactaggtcttgcaggggtatttttta |
20100887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University