View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19296_high_14 (Length: 355)
Name: NF19296_high_14
Description: NF19296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19296_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 18 - 348
Target Start/End: Complemental strand, 29006771 - 29006441
Alignment:
| Q |
18 |
atatctctttcagctttagtggtcgtgtgtttgaacaaactggtctaaaatttcaacaatgttaaaactcataaggagtattttgcagtcaattgtcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29006771 |
atatctctttcagctttagtggtcgtgtgtttgaacaatctggtctaaaatttcaacaatgttaaaactcataaggagtattttgcagtcaattgtcatt |
29006672 |
T |
 |
| Q |
118 |
ctactcaatttagagattagtgtttgctgctgtgctagagaatatccaatttttgaagaaaaaattgtttcacctaatgaaatgaacttctccaaatcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29006671 |
ctactcaatttagagattagtgtttgctgctgtgctagagaatatccaatttttgaagaaaaaattgtttcacctaatgaaatgaaattctccaaatcat |
29006572 |
T |
 |
| Q |
218 |
ttttaatgggtatacatgtaacatataggtaggtttaattgataaatagttgattcatggtccttaaagggagtaggttcaactcccatccccttcgtca |
317 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29006571 |
ttttaatgggtaaacatgtaacatataggttggtttaattgataaatagttgattcatggtccttaaagggagtagattcaactcccatccccttcgtca |
29006472 |
T |
 |
| Q |
318 |
ggactctaaatcttgattcatgcctttgcta |
348 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
29006471 |
ggactctaaatcttgattcatgccattgcta |
29006441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University