View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19296_high_27 (Length: 209)
Name: NF19296_high_27
Description: NF19296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19296_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 17 - 176
Target Start/End: Original strand, 30786912 - 30787071
Alignment:
| Q |
17 |
ctttgcatcaagataaattatgctactagttaaaaagaccaagtgccatcaaaggttgctttctccatgtcttgacaccactaagataagaaatcaatga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30786912 |
ctttgcatcaagataaattatgctactagttaaaaagaccaagtgccatcaaaggttgctttctccatgtcttgacaccactaagataagaaatcaatga |
30787011 |
T |
 |
| Q |
117 |
tcgccacatacctaaagtttggttctgtcataggtaatgcttttaagatttaattatcta |
176 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30787012 |
tcgccacatacctaaagtttgtttctgtcataggtaatgcttttaagatttaattatcta |
30787071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University