View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19296_low_15 (Length: 348)
Name: NF19296_low_15
Description: NF19296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19296_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 29449367 - 29449587
Alignment:
| Q |
1 |
caaatttggcgatgattttacaccatcctcataaaaaaccctaaatagatnnnnnnnnnntggaaaagaatcattgaacattaatgaaaagtaagaagca |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29449367 |
caaatttggagatgattttacaccatcctcataaaaaaccctaaatagacaaaaaaaaaa-ggaaaagaatcattgaacattaatgaaaagtaagaagca |
29449465 |
T |
|
| Q |
101 |
aaacctttaaatgagtctcaaaaacaatctcaacagcaacatcaagtaaacttttcaataaaacccgagctctctcaaccacctacaagaagcaaaatca |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29449466 |
aaacctttaaatgagtttcaaaaacaatctcaacagcaacatcaagtaaacttttcaataaaacccgagctctctcaaccacctacaagaagcaaaatca |
29449565 |
T |
|
| Q |
201 |
aaaaacatgaatgacattcatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29449566 |
aaaaacatgaatgacattcatg |
29449587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 332
Target Start/End: Original strand, 29449645 - 29449696
Alignment:
| Q |
281 |
gcatgtactacgaagcaccgacacatacacgaaacaaacattggtagtaatt |
332 |
Q |
| |
|
|||| |||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29449645 |
gcatatactactaagcaccaacacatacacgaaacaaacattggtagtaatt |
29449696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University