View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19296_low_9 (Length: 414)
Name: NF19296_low_9
Description: NF19296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19296_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 261 - 397
Target Start/End: Original strand, 29585934 - 29586070
Alignment:
| Q |
261 |
atctttgaactaaatctgcatatcttcatgtacagcatgaatgaaaaaataaagcttgttaaagatagaagcaagaatgacagaaagtgggtgcatcata |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29585934 |
atctttgaactaaatctgcatatcttcatgtacagcatgaatgaaaaaataaagcttgttaaagatagaagcaagaatgacagaaagtgggtgcatcata |
29586033 |
T |
 |
| Q |
361 |
tcccattggatgacacaattgaattgcagtttgattg |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29586034 |
tcccattggatgacacaattgaattgcagtttgattg |
29586070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University