View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_high_25 (Length: 361)
Name: NF19297_high_25
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 10 - 345
Target Start/End: Complemental strand, 31059068 - 31058733
Alignment:
| Q |
10 |
cagagacacatcaaaacctggatttggatctgatgtagttagcgcatcagtgatcattggattgagatcagacagtttagatttcaagcttgatatttca |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31059068 |
cagagacacatcaaaacatggatttggatctgatgtagttagcgcatcagtgatcattggattgagatcagacagtttagatttcaagcttgatatttca |
31058969 |
T |
|
| Q |
110 |
gtttttctaaaatcaaaatatgcattgaaatttggaccgtttaatcccgatttaacagctgttgatgtgctgactgtatgaatgcgtggagttgttgact |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31058968 |
gtttttctaaaatcaaaatatgcattgaaatttggaccgtttaatcctgatttaacagctgttgatgtgctgactgtatgaatgcatggagttgttgact |
31058869 |
T |
|
| Q |
210 |
tcagcaaatcaaaatcttatgtcacaagctacatacttggatctttttataaaactacggatttcactgtttatacatcaaattcaattttcaagcactg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31058868 |
tcagcaaatcaaaatcttatgtcacaagctacatacttggatctttttataaaactacggatttcactgtttatacatcaaattcaattttcaagcactg |
31058769 |
T |
|
| Q |
310 |
atatacctatttccatgaaaaatattcctaatttct |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31058768 |
atatacctatttccatgaaaaatattcctaatttct |
31058733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 95
Target Start/End: Original strand, 30520525 - 30520558
Alignment:
| Q |
62 |
atcattggattgagatcagacagtttagatttca |
95 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
30520525 |
atcattggattgagatcagacagtctagatttca |
30520558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University