View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_high_46 (Length: 256)
Name: NF19297_high_46
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_high_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 45 - 232
Target Start/End: Complemental strand, 38132732 - 38132560
Alignment:
| Q |
45 |
attgcaatttttgggtgtgattacatatcatccgaatgtaggtagatggattattcgagtcacataaaattataataatgagctgtaaagctctcatgca |
144 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38132732 |
attgtaatttttgggtgtgattacatatcatccgaatgtaggtagatggattattcgagtcacataaaatta---taatgagctgtaaagctctcatgca |
38132636 |
T |
|
| Q |
145 |
atattaaaactttttagatgtgaacttgagagagaacttgagagagatcagtcttcaattgtgtatggagaaaactagttatttacgg |
232 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38132635 |
atattaaaactttttagatgt------------gaacttgagagagatcagtcttcaattgtgtatggaaaaaactagttatttacgg |
38132560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University