View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19297_high_47 (Length: 255)

Name: NF19297_high_47
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19297_high_47
NF19297_high_47
[»] chr1 (4 HSPs)
chr1 (14-235)||(49458436-49458656)
chr1 (37-234)||(1248823-1249019)
chr1 (20-235)||(3545321-3545535)
chr1 (181-235)||(34824858-34824912)
[»] chr8 (5 HSPs)
chr8 (24-235)||(6984957-6985172)
chr8 (20-163)||(3938991-3939135)
chr8 (85-157)||(39432533-39432606)
chr8 (115-157)||(25192871-25192913)
chr8 (186-230)||(3938926-3938970)
[»] chr3 (3 HSPs)
chr3 (18-231)||(31921568-31921780)
chr3 (18-231)||(31674640-31674852)
chr3 (181-235)||(11237512-11237566)
[»] scaffold0555 (1 HSPs)
scaffold0555 (18-231)||(7378-7590)
[»] chr6 (3 HSPs)
chr6 (20-235)||(22532223-22532437)
chr6 (20-149)||(14844357-14844487)
chr6 (50-235)||(2364811-2364995)
[»] chr5 (1 HSPs)
chr5 (20-235)||(475919-476133)
[»] chr2 (2 HSPs)
chr2 (53-235)||(17689704-17689885)
chr2 (181-228)||(7300390-7300437)
[»] chr7 (1 HSPs)
chr7 (99-132)||(23898087-23898120)
[»] chr4 (1 HSPs)
chr4 (55-155)||(9690206-9690307)


Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 14 - 235
Target Start/End: Complemental strand, 49458656 - 49458436
Alignment:
14 attatactacttttggtgcagtttggcagcatattcgtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgaccatttt-ttcagtttat 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |||||||| ||||| |||| |||||    
49458656 attatactacttttggtgcagtttggcagcatattcgtgcgtggattggcgtgtcaggtgttgacccacatgatctcagtgactattttattcaatttat 49458557  T
113 taattgtacaggtcactcgacggcgcgtagatcctttcttcagcttatttgattacnnnnnnnnnnnngatgatttggaatgaacgcaacaacggacttt 212  Q
    |||||||||||||||||||| ||| ||||||||||||||||| |||||||| || |            |||| |||| ||||||||||||||  ||||||    
49458556 taattgtacaggtcactcgaaggcacgtagatcctttcttcaacttatttggttgc--tttgtgtgtggatggtttgaaatgaacgcaacaaatgacttt 49458459  T
213 ttaataatatccaaacatccatt 235  Q
    |||||||||||||||||| ||||    
49458458 ttaataatatccaaacattcatt 49458436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 37 - 234
Target Start/End: Original strand, 1248823 - 1249019
Alignment:
37 tggcagcatattcgtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgaccatttt-ttcagtttattaattgtacaggtcactcgacgg 135  Q
    |||||||||||||| || |||||||||||||||| |||||| ||||||||||| |||||  ||||| ||||||||||| | | |||||||||||||| ||    
1248823 tggcagcatattcgggcatggattggcgtgtcaggtgttgatcctcatgatattagtgagaattttattcagtttattcactatacaggtcactcgaagg 1248922  T
136 cgcgtagatcctttcttcagcttatttgattacnnnnnnnnnnnngatgatttggaatgaacgcaacaacggactttttaataatatccaaacatccat 234  Q
    || || ||||||||||||| |||||||| ||||            |||||||||||||||||||||||||  || ||||||||| |||||||| |||||    
1248923 cgtgtcgatcctttcttcaacttatttggttac--tttgtgtgtggatgatttggaatgaacgcaacaacaaacattttaataacatccaaacctccat 1249019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 20 - 235
Target Start/End: Original strand, 3545321 - 3545535
Alignment:
20 ctacttttggtgcagtttggcagcatattcgtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgaccatttt-ttcagtttattaattg 118  Q
    |||||||||| ||| ||||||||||||| |||||||||||||||||||| |  | ||| || |||||| | |||||||| ||| |||||||||||| |||    
3545321 ctacttttggcgcaatttggcagcatatccgtgcgtggattggcgtgtccggagctgatccccatgatcttagtgaccactttattcagtttattacttg 3545420  T
119 tacaggtcactcgacggcgcgtagatcctttcttcagcttatttgattacnnnnnnnnnnnngatgatttggaatgaacgcaacaacggactttttaata 218  Q
    |||||||||  ||| |||||||||||||||||| ||||| ||||| ||||            |||| |||| |||||| ||||||||  |||||||||||    
3545421 tacaggtcatacgagggcgcgtagatcctttctgcagctcatttggttac--tttgtgtatggatggtttgaaatgaaagcaacaacaaactttttaata 3545518  T
219 atatccaaacatccatt 235  Q
    ||| |||||||||||||    
3545519 atacccaaacatccatt 3545535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 181 - 235
Target Start/End: Original strand, 34824858 - 34824912
Alignment:
181 gatgatttggaatgaacgcaacaacggactttttaataatatccaaacatccatt 235  Q
    |||| |||||||||||||||||||| |||||||||||||||| ||||||||||||    
34824858 gatggtttggaatgaacgcaacaacagactttttaataatattcaaacatccatt 34824912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 24 - 235
Target Start/End: Original strand, 6984957 - 6985172
Alignment:
24 ttttggtgcagtttggcagcatattcgtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgaccatttt-ttcagtttattaattgtaca 122  Q
    |||||||||||||||||||||||||||||| |||||||||||||||  || ||||||||||||| |||||||||||||| ||||| ||||||||||||||    
6984957 ttttggtgcagtttggcagcatattcgtgcttggattggcgtgtcaagtgctgaccctcatgatctcagtgaccattttattcaggttattaattgtaca 6985056  T
123 ggtcactcgacggcgcgtagatcctttcttcagctt-----atttgattacnnnnnnnnnnnngatgatttggaatgaacgcaacaacggactttttaat 217  Q
    |||||||||| |||||||| ||||||||||||||||     ||||||||||            |||| |||||||||||||||||||| |||||||||||    
6985057 ggtcactcgaaggcgcgtatatcctttcttcagcttatttaatttgattac--tttgtgtgtggatggtttggaatgaacgcaacaacagactttttaat 6985154  T
218 aatatccaaacatccatt 235  Q
    ||||||||||||||||||    
6985155 aatatccaaacatccatt 6985172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 3939135 - 3938991
Alignment:
20 ctacttttggtgcagtttggcagcatattcgtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgaccatttt-ttcagtttattaattg 118  Q
    |||||||||| | |||||||||||||||  | || ||||||||||||| || |||||| ||||||||| |  |||| |||||| |||||||||| || ||    
3939135 ctacttttggcgtagtttggcagcatatctgggcatggattggcgtgttaggtgttgatcctcatgatctttgtgagcattttattcagtttatcaactg 3939036  T
119 tacaggtcactcgacggcgcgtagatcctttcttcagcttatttg 163  Q
    || ||||||||||| ||||||||||||||||||||||||||||||    
3939035 tataggtcactcgaaggcgcgtagatcctttcttcagcttatttg 3938991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 85 - 157
Target Start/End: Complemental strand, 39432606 - 39432533
Alignment:
85 gatatcagtgaccatttt-ttcagtttattaattgtacaggtcactcgacggcgcgtagatcctttcttcagct 157  Q
    |||||| ||||||||||  ||||||| ||| |||||||||||||||||| |  ||| |||||||||||||||||    
39432606 gatatcggtgaccatttccttcagttcattcattgtacaggtcactcgaggatgcgcagatcctttcttcagct 39432533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 157
Target Start/End: Complemental strand, 25192913 - 25192871
Alignment:
115 attgtacaggtcactcgacggcgcgtagatcctttcttcagct 157  Q
    ||||||||||||||||||||  ||| |||||||||||||||||    
25192913 attgtacaggtcactcgacgaagcgcagatcctttcttcagct 25192871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 230
Target Start/End: Complemental strand, 3938970 - 3938926
Alignment:
186 tttggaatgaacgcaacaacggactttttaataatatccaaacat 230  Q
    ||||||||  ||||||||||  |||||||||||||||||||||||    
3938970 tttggaatagacgcaacaacatactttttaataatatccaaacat 3938926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 31921568 - 31921780
Alignment:
18 tactacttttggtgcagtttggcagcatattcgtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgaccatttt-ttcagtttattaat 116  Q
    |||||||||||| ||||||||||||||||| |||||||||||||||||||| |  | ||||||||||||| | |||||||||||| ||||||||||||||    
31921568 tactacttttggcgcagtttggcagcatatccgtgcgtggattggcgtgtctggagctgaccctcatgatcttagtgaccattttattcagtttattaat 31921667  T
117 tgtacaggtcactcgacggcgcgtagatcctttcttcagcttatttgattacnnnnnnnnnnnngatgatttggaatgaacgcaacaacggactttttaa 216  Q
    || ||||||||| ||| |||||||||||||||||||||||| ||||| ||||            |||| |||||||||||||||||||| ||||||||||    
31921668 tgcacaggtcacacgaaggcgcgtagatcctttcttcagctcatttggttac--tatgtgtgtggatggtttggaatgaacgcaacaacagactttttaa 31921765  T
217 taatatccaaacatc 231  Q
    |||||||||||||||    
31921766 taatatccaaacatc 31921780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 31674852 - 31674640
Alignment:
18 tactacttttggtgcagtttggcagcatattcgtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgaccatttt-ttcagtttattaat 116  Q
    |||||||||||| ||||||||||||||||| |||||||||||||| ||||| |  | ||||||||||||| | |||||||||||| ||||||||||||||    
31674852 tactacttttggcgcagtttggcagcatatccgtgcgtggattggtgtgtctggagctgaccctcatgatcttagtgaccattttattcagtttattaat 31674753  T
117 tgtacaggtcactcgacggcgcgtagatcctttcttcagcttatttgattacnnnnnnnnnnnngatgatttggaatgaacgcaacaacggactttttaa 216  Q
    || ||||||||| ||| |||||||||||||||||||||||| ||||| ||||            |||| |||||||||||||||||||| ||||||||||    
31674752 tgcacaggtcacacgaaggcgcgtagatcctttcttcagctcatttggttac--tatgtgtgtggatggtttggaatgaacgcaacaacagactttttaa 31674655  T
217 taatatccaaacatc 231  Q
    |||||||||||||||    
31674654 taatatccaaacatc 31674640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 181 - 235
Target Start/End: Complemental strand, 11237566 - 11237512
Alignment:
181 gatgatttggaatgaacgcaacaacggactttttaataatatccaaacatccatt 235  Q
    |||| |||||||||||||||||||| ||||||||||||||| |||||||||||||    
11237566 gatggtttggaatgaacgcaacaacagactttttaataatacccaaacatccatt 11237512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0555 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: scaffold0555
Description:

Target: scaffold0555; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 7590 - 7378
Alignment:
18 tactacttttggtgcagtttggcagcatattcgtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgaccatttt-ttcagtttattaat 116  Q
    |||||||||||| ||||||||||||||||| |||||||||||||||||||| |  | ||||||||||||| | |||||||||||| ||||||||||||||    
7590 tactacttttggcgcagtttggcagcatatccgtgcgtggattggcgtgtctggagctgaccctcatgatcttagtgaccattttattcagtttattaat 7491  T
117 tgtacaggtcactcgacggcgcgtagatcctttcttcagcttatttgattacnnnnnnnnnnnngatgatttggaatgaacgcaacaacggactttttaa 216  Q
    |||||||||||| | | | |||||||||||||| ||||||| ||||| ||||            |||| |||||||||||||||||||| ||||||||||    
7490 tgtacaggtcacacaaagacgcgtagatcctttattcagctcatttggttac--tatgtgtgtggatggtttggaatgaacgcaacaacagactttttaa 7393  T
217 taatatccaaacatc 231  Q
    |||||||||||||||    
7392 taatatccaaacatc 7378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 20 - 235
Target Start/End: Complemental strand, 22532437 - 22532223
Alignment:
20 ctacttttggtgcagtttggcagcatattcgtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgaccatttt-ttcagtttattaattg 118  Q
    |||||||||  ||||||||||||||||| |||||||||||||||||||| || | ||| || |||||| | |||||||||||| |||||||||||| |||    
22532437 ctacttttgacgcagtttggcagcatatccgtgcgtggattggcgtgtccgaagctgatccccatgatcttagtgaccattttattcagtttattacttg 22532338  T
119 tacaggtcactcgacggcgcgtagatcctttcttcagcttatttgattacnnnnnnnnnnnngatgatttggaatgaacgcaacaacggactttttaata 218  Q
    |||||||||  ||| |||||||||||||||| | ||||| ||||| ||||            |||| |||||||||||||||||||| ||||||||||||    
22532337 tacaggtcatacgagggcgcgtagatcctttatgcagctcatttggttac--tttgtgtgtggatggtttggaatgaacgcaacaacagactttttaata 22532240  T
219 atatccaaacatccatt 235  Q
    ||| |||||||||||||    
22532239 atacccaaacatccatt 22532223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 20 - 149
Target Start/End: Original strand, 14844357 - 14844487
Alignment:
20 ctacttttggtgcagtttggcagcatattcgtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgacca-ttttttcagtttattaattg 118  Q
    |||||||||| ||||||||||||||||| |||||||||||||||||||| |  | ||| || |||||| | |||||||| ||| |||||||||||| |||    
14844357 ctacttttggcgcagtttggcagcatatccgtgcgtggattggcgtgtccggagctgatccccatgatcttagtgaccactttattcagtttattacttg 14844456  T
119 tacaggtcactcgacggcgcgtagatccttt 149  Q
    |||||||||  ||| ||||||||||||||||    
14844457 tacaggtcatacgagggcgcgtagatccttt 14844487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 50 - 235
Target Start/End: Complemental strand, 2364995 - 2364811
Alignment:
50 gtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgaccatttt-ttcagtttattaattgtacaggtcactcgacggcgcgtagatcctt 148  Q
    |||| |||||||||||||| |  | ||| || |||||| | |||||||| ||| |||||||||||| ||||||||||||  ||| | |||||||||||||    
2364995 gtgcatggattggcgtgtccggagctgatccccatgatcttagtgaccactttattcagtttattacttgtacaggtcatacgaggacgcgtagatcctt 2364896  T
149 tcttcagcttatttgattacnnnnnnnnnnnngatgatttggaatgaacgcaacaacggactttttaataatatccaaacatccatt 235  Q
    | | ||||| ||||| ||||            |||| |||| ||||||||||||||| ||||||||||||||| |||||||||||||    
2364895 tatgcagctcatttggttactttgtgtgtg--gatggtttgaaatgaacgcaacaacagactttttaataatacccaaacatccatt 2364811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 20 - 235
Target Start/End: Complemental strand, 476133 - 475919
Alignment:
20 ctacttttggtgcagtttggcagcatattcgtgcgtggattggcgtgtcagatgttgaccctcatgatatcagtgacca-ttttttcagtttattaattg 118  Q
    |||||||||| |||||||||||||||||||||||||||||| ||||||| |  | ||| || |||||| | |||||||| ||| |||||||||||| |||    
476133 ctacttttggcgcagtttggcagcatattcgtgcgtggattagcgtgtccggagctgatccccatgatcttagtgaccactttattcagtttattacttg 476034  T
119 tacaggtcactcgacggcgcgtagatcctttcttcagcttatttgattacnnnnnnnnnnnngatgatttggaatgaacgcaacaacggactttttaata 218  Q
    |||||||||  ||| |||||||||||||||| | ||||| ||||| ||||            |||| |||||||||||||||||||| ||||||||||||    
476033 tacaggtcatacgagggcgcgtagatcctttatgcagctcatttggttac--tttgtgtgtggatggtttggaatgaacgcaacaacagactttttaata 475936  T
219 atatccaaacatccatt 235  Q
    ||| |||||||||||||    
475935 atacccaaacatccatt 475919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 53 - 235
Target Start/End: Complemental strand, 17689885 - 17689704
Alignment:
53 cgtggattggcgtgtcagatgttgaccctcatgatatcagtgaccatttt-ttcagtttattaattgtacaggtcactcgacggcgcgtagatcctttct 151  Q
    |||||||||||||||| || | |||  | |||||| | |||||||| ||| |||||||||||| | |||| |||||  ||| ||||||||||||||||||    
17689885 cgtggattggcgtgtccgaagctgattcccatgatcttagtgaccactttattcagtttattactagtacgggtcatacgagggcgcgtagatcctttct 17689786  T
152 tcagcttatttgattacnnnnnnnnnnnngatgatttggaatgaacgcaacaacggactttttaataatatccaaacatccatt 235  Q
     ||||| ||||| ||||            |||| |||||||||||||||||||| ||||||||||||||| |||||||||||||    
17689785 gcagctcatttggttactttgtgtgtg--gatggtttggaatgaacgcaacaacagactttttaataatacccaaacatccatt 17689704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 181 - 228
Target Start/End: Complemental strand, 7300437 - 7300390
Alignment:
181 gatgatttggaatgaacgcaacaacggactttttaataatatccaaac 228  Q
    |||| ||||||||||| ||||||||||||| |||||||| ||||||||    
7300437 gatggtttggaatgaatgcaacaacggactatttaataacatccaaac 7300390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 132
Target Start/End: Complemental strand, 23898120 - 23898087
Alignment:
99 ttttttcagtttattaattgtacaggtcactcga 132  Q
    ||||||||||||||| ||||||||||||||||||    
23898120 ttttttcagtttattcattgtacaggtcactcga 23898087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 55 - 155
Target Start/End: Complemental strand, 9690307 - 9690206
Alignment:
55 tggattggcgtgtcagatgttgaccctcatgatatcagtgaccattttt-tcagtttattaattgtacaggtcactcgacggcgcgtagatcctttcttc 153  Q
    |||||||| |||||||  |||||||||||  ||||  |||||||||| | ||| |||||| ||| |||||||||||| |  |||||||| || |||||||    
9690307 tggattggtgtgtcaggagttgaccctcaaaatattcgtgaccatttctatcaatttattcattctacaggtcactcaagagcgcgtaggtcgtttcttc 9690208  T
154 ag 155  Q
    ||    
9690207 ag 9690206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University