View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_high_58 (Length: 237)
Name: NF19297_high_58
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_high_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 35450816 - 35450654
Alignment:
| Q |
1 |
attacctaaggattgctattagtgttgagttctctcttttccctccttcccctcttccaaattcttgcagtattccatcttctattcagctgaccttaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35450816 |
attacctaaggattgctattagtgttgagttctctcttttccctccttcccctcttccaagttcttgcagtattccatcttctattcagctgaccttaca |
35450717 |
T |
 |
| Q |
101 |
tgtacttgctaacaataatttctgtgactcattacaggttcgaaatctcatagaacgatgcat |
163 |
Q |
| |
|
||||||||||||||||||||| | || ||||||||| | |||||||| ||||||||||||| |
|
|
| T |
35450716 |
tgtacttgctaacaataatttttttgcttcattacagatgtgaaatctcgtagaacgatgcat |
35450654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 96 - 221
Target Start/End: Complemental strand, 35450643 - 35450518
Alignment:
| Q |
96 |
ttacatgtacttgctaacaataatttctgtgactcattacaggttcgaaatctcatagaacgatgcatgcaatcgtatatgagcccgaaagaagtagcga |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35450643 |
ttacatgtacttgctaacaataatttctttgactcattacaggtgcgaaatctcatagaacgatgcatgcaatcgtatatgagcccgaaagaagtagcga |
35450544 |
T |
 |
| Q |
196 |
actcactactgaatgaagcaaaaata |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35450543 |
actcactactgaatgaagcaaaaata |
35450518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 188
Target Start/End: Original strand, 1863679 - 1863739
Alignment:
| Q |
128 |
ctcattacaggttcgaaatctcatagaacgatgcatgcaatcgtatatgagcccgaaagaa |
188 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||| ||||||||| || |||||| |
|
|
| T |
1863679 |
ctcattacaggtgaaaaatctcatagagcgatgcatgcaattgtatatgagtccaaaagaa |
1863739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University