View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_high_70 (Length: 215)
Name: NF19297_high_70
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_high_70 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 38695670 - 38695585
Alignment:
| Q |
1 |
gttgagtataaaggaaaacctttaatgatacaaataagtcttgcagaaaacttagagaaagaaaacgtctcttgcaaaataacatt |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
38695670 |
gttgagtataaaggaaaacctttaatgatacaaataagtcttgcagaaaatttagagaaagaaaaggtctcttgcaaaataacatt |
38695585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 124 - 184
Target Start/End: Complemental strand, 38695548 - 38695488
Alignment:
| Q |
124 |
tgttttggtgagtggacgctagtttgttgcagctaactattatgattcttctacttttcgc |
184 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38695548 |
tgttttggtgagtggacactagtttgttgcaactaactattatgattcttctacttttcgc |
38695488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University