View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_low_16 (Length: 404)
Name: NF19297_low_16
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 7 - 394
Target Start/End: Complemental strand, 52600352 - 52599940
Alignment:
| Q |
7 |
acttcaactacctgactgttgattagttgggataatcctcttcatcacctcttctggtaaattgccaagcacaaataacagaaatatggttatttttata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52600352 |
acttcaactacctgactgttgattagttgggataatcctcttcatcacctcttctggtaaattgccaagcacaaataacagaaatatggttatttttata |
52600253 |
T |
 |
| Q |
107 |
agccgcgcaaccatgggcaaaattaaactaaattatatatgttgctatgtaagcattaaatagt-------------------tttttaggcttgtttga |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||| |
|
|
| T |
52600252 |
agccgcgcaaccatgggcaaaattaaactaaattatatatgttgctatttaagcattaaatagtataggtgttgaatattttgtatttaggcttgtttga |
52600153 |
T |
 |
| Q |
188 |
atattatatatgtaagcacaaccatggttatttttatccactgcttaaacgcttgcaagtctgaagagcttatgaaaatagttttt----------taag |
277 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52600152 |
atat----tatgtaagcacaaccatggttatttttatccactgcttaaacgcttgcaagtctgaagagcttatgaaaatagttttttaaacgtccataag |
52600057 |
T |
 |
| Q |
278 |
ttgttttcagtttatttccatcaattcttaagtaaagtttataaaaacaatttgactttactttatattttgtggtaaactttttatgaagttttatcat |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52600056 |
ttgttttcagtttatttccatcaattcttaagtaaagtttataaaaacaatttgactttactttatattttgtggtaaactttttatgaagttttatcat |
52599957 |
T |
 |
| Q |
378 |
attaccttgcttctgtg |
394 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52599956 |
attaccttgcttctgtg |
52599940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University