View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19297_low_17 (Length: 404)
Name: NF19297_low_17
Description: NF19297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19297_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 160 - 395
Target Start/End: Original strand, 45001720 - 45001955
Alignment:
| Q |
160 |
gtgaaataaaaatttccattttattgcagtgtcactatcatgaaaccagaccccgtcatcttgaaccagaaatggaaattcctacccacgaaagtgaaca |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45001720 |
gtgaaataaaaatttccattttattgcagtgtcactatcatgaaaccagaccccgtcatcttaaaccagaaatggaaattcctacccacgaaattgaaca |
45001819 |
T |
 |
| Q |
260 |
aacacttaccaagttagaaaccaacccatcattacaacttcttctagagtttgaaggtagaatcattgagtggcgccggtttaaatgcttctatttgtgg |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45001820 |
aacacttaccaagttagaaaccaacccatcattacaacttcttctagagtttgaaggtagaatcattgagtggcgccggtttaaatgcttctatttgtgg |
45001919 |
T |
 |
| Q |
360 |
gctaccaacttcattttcacgttaacttagtattat |
395 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45001920 |
gctaccaacttcattttcacgttaacttaatattat |
45001955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 17 - 102
Target Start/End: Original strand, 45001626 - 45001715
Alignment:
| Q |
17 |
acatgctaatcctaaatagaagcagtaa----gtgtcgcccgtggatttgcaagttgcaacagcttgattgggttaaatatcgtacgaaa |
102 |
Q |
| |
|
|||||||||| ||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45001626 |
acatgctaattctaaatagaagcaataattaagtgtcgcccgtggatttgcatgttgcaacagcttgattgggttaaatatcgtacgaaa |
45001715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University